enigmadiagnostics

cell nuclear antigen directly interacts with androgen receptor and enhances androgen

Proliferating cell nuclear antigen straight interacts with androgen receptor and enhances androgen receptor‑mediated signaling

Androgen receptor (AR) and/or its constitutively lively splicing variants (AR‑Vs), resembling AR‑V7 and ARv567es, is required for prostate most cancers cell progress and survival, and most cancers development. Proliferating cell nuclear antigen (PCNA) is preferentially overexpressed in all cancers and executes its capabilities via interplay with quite a few associate proteins. The purpose of the current research was to analyze the potential position of PCNA within the regulation of AR exercise.

An equivalent consensus sequence of the PCNA‑interacting protein‑field (PIP‑field) was recognized on the N‑terminus of human, mouse and rat AR proteins. It was discovered that PCNA complexes with the complete‑size AR (AR‑FL) and AR‑V7, which might be attenuated by the small molecule PIP‑field inhibitor, T2AA. PCNA additionally complexes with ARv567es and recombinant AR protein. The PCNA inhibitors, PCNA‑I1S and T2AA, inhibited AR transcriptional exercise and the expression of AR goal genes in LNCaP‑AI and 22Rv1 cells, however not in AR‑detrimental PC‑three cells. The knockdown of PCNA expression lowered dihydrotestosterone‑stimulated AR transcriptional exercise and abolished the inhibitory impact of PCNA‑I1S on AR exercise. The PCNA inhibitor, PCNA‑I1, exerted additive progress inhibitory results with androgen deprivation and enzalutamide in cells expressing AR‑FL or AR‑FL/AR‑V7, however not in AR‑detrimental PC‑three cells.

Lastly, R9‑AR‑PIP, a small peptide mimicking AR PIP‑field, was discovered to bind to GFP‑PCNA at Okd of two.73 µM and inhibit the expression of AR goal genes, AR transcriptional exercise and the expansion of AR‑expressing cells. On the entire, these information strongly counsel that AR is a PCNA associate protein and interacts with PCNA through the PIP‑field and that concentrating on the PCNA‑AR interplay might characterize an revolutionary and selective therapeutic technique towards prostate most cancers, notably castration‑resistant prostate cancers overexpressing constitutively lively AR‑Vs.

A framework for extremely multiplexed dextramer mapping and prediction of T cell receptor sequences to antigen specificity

T cell receptor (TCR) antigen-specific recognition is crucial for the adaptive immune system. Nevertheless, constructing a TCR-antigen interplay map has been difficult because of the staggering range of TCRs and antigens. Accordingly, extremely multiplexed dextramer-TCR binding assays have been not too long ago developed, however the utility of the following giant datasets is proscribed by the dearth of strong computational strategies for normalization and interpretation.

Right here, we current a computational framework comprising a novel technique, ICON (Integrative COntext-specific Normalization), for figuring out dependable TCR-pMHC (peptide-major histocompatibility complicated) interactions and a neural network-based classifier TCRAI that outperforms different state-of-the-art strategies for TCR-antigen specificity prediction. We additional demonstrated that by combining ICON and TCRAI, we’re capable of uncover novel subgroups of TCRs that bind to a given pMHC through totally different mechanisms. Our framework facilitates the identification and understanding of TCR-antigen-specific interactions for primary immunological analysis and medical immune monitoring.

enigmadiagnostics

CORNING® REUSABLE PHENOLIC GPI 28-400 THREADED SCREW CAP WITH RUBBER LINER
9999-28 144/pk
EUR 240
Description: General Apparatus; Stoppers
Mouse pre-microRNA Expression Construct mir-28
MMIR-28-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools
EBAG9 antibody
70R-16981 50 ul
EUR 435
Description: Rabbit polyclonal EBAG9 antibody
EBAG9 antibody
38323-100ul 100ul
EUR 252
EBAG9 Antibody
DF6703 200ul
EUR 304
Description: EBAG9 Antibody detects endogenous levels of total EBAG9.
EBAG9 antibody
70R-9916 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EBAG9 antibody
EBAG9 Antibody
1-CSB-PA007355GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EBAG9. Recognizes EBAG9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
EBAG9 siRNA
20-abx901624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 siRNA
20-abx914879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 siRNA
20-abx914880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 Antibody
ABD6703 100 ug
EUR 438
EBAG9 protein (His tag)
80R-1093 100 ug
EUR 224
Description: Purified recombinant Human EBAG9 protein
CMV (Cytomegalovirus Antibody IgG) ELISA test
28 96T/Box Ask for price
  • Area of application: Prepotency testing
Description: ELISA based test for quantitative detection of CMV (Cytomegalovirus Antibody IgG)
RNU6-28 Recombinant Protein (Human)
RP089073 100 ug Ask for price
Recombinant HPV-28 E1 Protein
VAng-Wyb3131-inquire inquire Ask for price
Description: Human papillomavirus type 28 Replication protein E1, recombinant protein.
Recombinant HPV-28 L1 Protein
VAng-Wyb3136-inquire inquire Ask for price
Description: Human papillomavirus type 28 Major capsid protein L1, recombinant protein.
EBAG9 Blocking Peptide
33R-2039 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBAG9 antibody, catalog no. 70R-9916
Human EBAG9 Antibody
32605-05111 150 ug
EUR 261
EBAG9 Blocking Peptide
DF6703-BP 1mg
EUR 195
EBAG9 Conjugated Antibody
C38323 100ul
EUR 397
EBAG9 cloning plasmid
CSB-CL007355HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.
EBAG9 cloning plasmid
CSB-CL007355HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.
EBAG9 Rabbit pAb
A8385-100ul 100 ul
EUR 308
EBAG9 Rabbit pAb
A8385-200ul 200 ul
EUR 459
EBAG9 Rabbit pAb
A8385-20ul 20 ul Ask for price
EBAG9 Rabbit pAb
A8385-50ul 50 ul Ask for price
EBAG9 Rabbit pAb
A1935-100ul 100 ul
EUR 308
EBAG9 Rabbit pAb
A1935-200ul 200 ul
EUR 459
EBAG9 Rabbit pAb
A1935-20ul 20 ul
EUR 183
EBAG9 Rabbit pAb
A1935-50ul 50 ul
EUR 223
Anti-EBAG9 Antibody
PB9553 100ug/vial
EUR 334
pCMV-SPORT6-EBAG9
PVT13493 2 ug
EUR 391
Anti-EBAG9 antibody
STJ110683 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.
Anti-EBAG9 antibody
STJ23462 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.
Anti-EBAG9 (4A10)
YF-MA16699 100 ug
EUR 363
Description: Mouse monoclonal to EBAG9
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-100ug
QP5959-ec-100ug 100ug
EUR 408
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-10ug
QP5959-ec-10ug 10ug
EUR 200
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-1mg
QP5959-ec-1mg 1mg
EUR 1632
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-200ug
QP5959-ec-200ug 200ug
EUR 634
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-500ug
QP5959-ec-500ug 500ug
EUR 1060
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-50ug
QP5959-ec-50ug 50ug
EUR 263
IL-28, human recombinant
4978-1000
EUR 5204
IL-28, human recombinant
4978-20
EUR 294
Matrix Metalloproteinase-28 (Recombinant)
20-abx073425
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Recombinant Keratin 28 (KRT28)
4-RPS214Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A6BLY7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 80.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Keratin 28 expressed in: E.coli
Recombinant Human Vacuolar Protein Sorting 28
7-06871 10µg Ask for price
Recombinant Human Vacuolar Protein Sorting 28
7-06872 50µg Ask for price
Recombinant Human Vacuolar Protein Sorting 28
7-06873 1mg Ask for price
Polyclonal EBAG9 Antibody (Center)
APR04492G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:
Rat EBAG9 shRNA Plasmid
20-abx989010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse EBAG9 shRNA Plasmid
20-abx974569
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Polyclonal EBAG9 Antibody (Center)
APR06938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:
Human EBAG9 shRNA Plasmid
20-abx956064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-EBAG9 / RCAS1 antibody
STJ70947 100 µg
EUR 359
PRSS28 Protease Serine 28 Mouse Recombinant Protein
PROTQ924N9 Regular: 5ug
EUR 317
Description: PRSS28 Mouse Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 256 amino acids (27-274a.a.) and having a molecular mass of 28.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa)._x000D_PRSS28 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
MMP28 Matrix Metalloproteinase-28 Human Recombinant Protein
PROTQ9H239 Regular: 20ug
EUR 317
Description: MMP28 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 421 amino acids (123-520a.a) and having a molecular mass of 47.3kDa. MMP28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-100g 100 µg
EUR 1013
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)
Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-1mg 1 mg
EUR 6402
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)
Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-20g 20 µg
EUR 594
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)
Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-50g 50 µg
EUR 1013
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-1mgEcoli 1 mg (E. coli)
EUR 2577
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-500gEcoli 500 µg (E. coli)
EUR 1747
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-50gEcoli 50 µg (E. coli)
EUR 1197
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-100g 100 µg
EUR 7254
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)
Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-50g 50 µg
EUR 4765
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-100g 100 µg
EUR 1150
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-1mg 1 mg
EUR 3913
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-500g 500 µg
EUR 2663
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-1mg 1 mg
EUR 3390
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-200g 200 µg
EUR 1370
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-500g 500 µg
EUR 2223
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-1mg 1 mg
EUR 5852
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)
Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-500g 500 µg
EUR 3583
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)
Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-500g 500 µg
EUR 6415
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)
Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-50g 50 µg
EUR 1246
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)
VPS28 Vacuolar Protein Sorting 28 Human Recombinant Protein
PROTQ9UK41 Regular: 50ug
EUR 317
Description: VPS28 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-221 a.a.) and having a molecular mass of 25.4kDa.;The VPS28 is purified by proprietary chromatographic techniques.
EBAG9 Protein Vector (Mouse) (pPB-C-His)
PV174238 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPB-N-His)
PV174239 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPM-C-HA)
PV174240 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPM-C-His)
PV174241 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPB-C-His)
PV265294 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPB-N-His)
PV265295 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPM-C-HA)
PV265296 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPM-C-His)
PV265297 500 ng
EUR 603
EBAG9 Protein Vector (Human) (pPB-C-His)
PV013461 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-N-His)
PV013462 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013463 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-His)
PV013464 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-C-His)
PV013465 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-N-His)
PV013466 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013467 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-His)
PV013468 500 ng
EUR 329
Human EBAG9 Antibody (Biotin Conjugate)
32605-05121 150 ug
EUR 369
Ebag9 ORF Vector (Rat) (pORF)
ORF066324 1.0 ug DNA
EUR 506
EBAG9 ORF Vector (Human) (pORF)
ORF003366 1.0 ug DNA
EUR 95
EBAG9 ORF Vector (Human) (pORF)
ORF003367 1.0 ug DNA
EUR 95

Quantifying persistence within the T-cell signaling community utilizing an optically controllable antigen receptor

T cells discriminate between wholesome and contaminated cells with exceptional sensitivity when mounting an immune response, which is hypothesized to depend upon T cells combining stimuli from a number of antigen-presenting cell interactions right into a stronger response. To quantify the capability for T cells to perform this, we’ve got developed an antigen receptor that’s optically tunable inside cell conjugates, offering management over the length, and depth of intracellular T-cell signaling.

We observe restricted persistence inside the T-cell intracellular community on disruption of receptor enter, with alerts dissipating totally in ~15 min, and straight present sustained proximal receptor signaling is required to keep up gene transcription. T cells thus primarily accumulate the outputs of gene expression fairly than combine discrete intracellular alerts. Engineering optical management in a clinically related chimeric antigen receptor (CAR), we present that this restricted sign persistence might be exploited to extend CAR-T cell activation threefold utilizing pulsatile stimulation. Our outcomes are more likely to apply extra usually to the signaling dynamics of different mobile networks.

Tumor rejection properties of gp100 209-specific T cells correlate with T cell receptor binding affinity in direction of the wild kind fairly than anchor-modified antigen

Though there are exceptions and outliers, T cell useful responses usually correlate with the affinity of a TCR for a peptide/MHC complicated. In a single not too long ago described outlier case, essentially the most promising medical candidate in a sequence of TCRs particular for the gp100209 melanoma antigen certain with the weakest answer affinity and produced the least quantity of cytokine in vitro. Hypotheses for this outlier habits included uncommon cytokine expression patterns arising from an atypical TCR binding geometry. Finding out this occasion in additional element, we discovered right here that outlier habits is attributable to not uncommon cytokine patterns or TCR binding, however using a place 2 anchor-modified peptide variant in in vitro experiments as an alternative of the wild kind antigen that’s current in vivo.

Though the anchor-modified variant has been broadly utilized in primary and medical immunology as a surrogate for the wild kind peptide, prior work has proven that TCRs can clearly distinguish between the 2. We present that when this differential recognition is accounted for, the useful properties of gp100209-specific TCRs monitor with their affinity in direction of the peptide/MHC complicated. Past demonstrating the correlates with T cell perform for a clinically related TCR, our outcomes present necessary concerns for number of TCRs for immunotherapy and using modified peptides in immunology.

 

Novel high-affinity EGFRvIII-specific chimeric antigen receptor T cells successfully remove human glioblastoma

Targets: The growing success of Chimeric Antigen Receptor (CAR) T cell remedy in haematological malignancies is reinvigorating its software in lots of different most cancers sorts and with renewed deal with its software to strong tumors. We current a novel CAR towards glioblastoma, an aggressive, malignant glioma, with a dismal survival charge for which therapy choices have remained unchanged for over a decade.

Strategies: We use the human Retained Show (ReD) antibody platform (Myrio Therapeutics) to establish a novel single-chain variable fragment (scFv) that recognises epidermal progress issue receptor mutant variant III (EGFRvIII), a standard and tumor-specific mutation present in glioblastoma. We use each in vitro useful assays and an in vivo orthotopic xenograft mannequin of glioblastoma to look at the perform of our novel CAR, referred to as GCT02, focused utilizing murine CAR T cells.

Outcomes: Our EGFRvIII-specific scFv was discovered to be of a lot greater affinity than reported comparators reverse-engineered from monoclonal antibodies. Regardless of the upper affinity, GCT02 CAR T cells kill equivalently however secrete decrease quantities of cytokine. As well as, GCT02-CAR T cells additionally mediate speedy and full tumor elimination in vivo.

Conclusion: We current a novel EGFRvIII-specific CAR, with efficient antitumor capabilities each in in vitro and in a xenograft mannequin of human glioblastoma.

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723393 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723399 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723405 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723411 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723417 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723423 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723429 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723435 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723441 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723447 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723453 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723459 1.0 ug DNA Ask for price

DUX4L10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723465 1.0 ug DNA Ask for price

DUX4L11 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723471 1.0 ug DNA Ask for price

DUX4L14 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723477 1.0 ug DNA Ask for price

DUX4L16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723483 1.0 ug DNA Ask for price

DUX4L17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723489 1.0 ug DNA Ask for price

DUX4L18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723495 1.0 ug DNA Ask for price

DUX4L19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723501 1.0 ug DNA Ask for price

DUXB Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723507 1.0 ug DNA Ask for price

DVL1L1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723513 1.0 ug DNA Ask for price

DWS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723519 1.0 ug DNA Ask for price

DYNLL1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723525 1.0 ug DNA Ask for price

DYRK1AIP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723531 1.0 ug DNA Ask for price

DYRK1AIP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723537 1.0 ug DNA Ask for price

DYT2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723543 1.0 ug DNA Ask for price

DYT4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723549 1.0 ug DNA Ask for price

DYT7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723555 1.0 ug DNA Ask for price

DYT10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723561 1.0 ug DNA Ask for price

DYT13 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723567 1.0 ug DNA Ask for price

DYT15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723573 1.0 ug DNA Ask for price

DYT17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723579 1.0 ug DNA Ask for price

DYT21 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723585 1.0 ug DNA Ask for price

DYT22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723591 1.0 ug DNA Ask for price

DYX1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723597 1.0 ug DNA Ask for price

DYX2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723609 1.0 ug DNA Ask for price

DYX3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723615 1.0 ug DNA Ask for price

DYX4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723621 1.0 ug DNA Ask for price

DYX5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723627 1.0 ug DNA Ask for price

DYX6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723633 1.0 ug DNA Ask for price

DYX7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723639 1.0 ug DNA Ask for price

DYX8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723645 1.0 ug DNA Ask for price

DYX9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723651 1.0 ug DNA Ask for price

E2F3P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723663 1.0 ug DNA Ask for price

E2F4P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723669 1.0 ug DNA Ask for price

E11S Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723675 1.0 ug DNA Ask for price

EBM Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723687 1.0 ug DNA Ask for price

EBR3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723693 1.0 ug DNA Ask for price

EBR4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723699 1.0 ug DNA Ask for price

EBVM1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723705 1.0 ug DNA Ask for price

EBVS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723711 1.0 ug DNA Ask for price

ECA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723717 1.0 ug DNA Ask for price

ECEL1P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723723 1.0 ug DNA Ask for price

ECEL1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723729 1.0 ug DNA Ask for price

EDDM3DP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723735 1.0 ug DNA Ask for price

EEC1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723741 1.0 ug DNA Ask for price

EEC2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723747 1.0 ug DNA Ask for price

EEF1A1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723753 1.0 ug DNA Ask for price

EEF1A1P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723759 1.0 ug DNA Ask for price

EEF1A1P15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723765 1.0 ug DNA Ask for price

EEF1A1P16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723771 1.0 ug DNA Ask for price

EEF1A1P17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723777 1.0 ug DNA Ask for price

EEF1A1P18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723783 1.0 ug DNA Ask for price

EEF1A1P22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723789 1.0 ug DNA Ask for price

EEF1A1P23 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723795 1.0 ug DNA Ask for price

EEF1A1P25 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723801 1.0 ug DNA Ask for price

EEF1A1P26 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723807 1.0 ug DNA Ask for price

EEF1A1P28 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723813 1.0 ug DNA Ask for price

EEF1A1P29 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723819 1.0 ug DNA Ask for price

EEF1A1P30 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723825 1.0 ug DNA Ask for price

EEF1A1P31 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723831 1.0 ug DNA Ask for price

EEF1A1P33 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723837 1.0 ug DNA Ask for price

EEF1A1P34 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723843 1.0 ug DNA Ask for price

EEF1A1P35 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723849 1.0 ug DNA Ask for price

EEF1A1P38 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723855 1.0 ug DNA Ask for price

EEF1A1P40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723861 1.0 ug DNA Ask for price

EEF1A1P41 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723867 1.0 ug DNA Ask for price

EEF1A3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723873 1.0 ug DNA Ask for price

EEF1B2P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723879 1.0 ug DNA Ask for price

EEF1DP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723885 1.0 ug DNA Ask for price

EEF1DP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723891 1.0 ug DNA Ask for price

EEGV1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723897 1.0 ug DNA Ask for price

EGI Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723933 1.0 ug DNA Ask for price

EIF2AP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723951 1.0 ug DNA Ask for price

EIF2AP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723957 1.0 ug DNA Ask for price

EIF2AP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723963 1.0 ug DNA Ask for price

EIF2AP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723969 1.0 ug DNA Ask for price

EIF2S2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723987 1.0 ug DNA Ask for price

EIF2S2P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723993 1.0 ug DNA Ask for price

EIF2S2P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723999 1.0 ug DNA Ask for price

Leave a Reply

Your email address will not be published. Required fields are marked *

© 2021 Enigma ML, Enigma Diagnostics - Proudly powered by theme Octo